should be corrected to vs should be corrected into

Both phrases are correct, but they are used in different contexts. 'Should be corrected to' is used when referring to the correction of errors or mistakes in a specific form or content. On the other hand, 'should be corrected into' is used when talking about transforming something into a different form or state.

Last updated: April 12, 2024 • 242 views

This phrase is correct and commonly used when referring to the correction of errors or mistakes in a specific form or content.

"should be corrected to"

This phrase is used when indicating the correct version or form that something should take after an error or mistake has been identified.

Examples:

The spelling of that word should be corrected to 'receive'.
The address in the document should be corrected to the new location.

Show examples from the web [+]

... how small amounts of astigmatism affect visual acuity and the minimum astigmatism values that should be corrected to achieve maximum visual performance.
Madam The online version should be corrected to read: Mr. BONNER of Alabama. Madam January 22, 2008--On Page E59 the following appeared: Ms. SOLIS.
Sep 15, 2020 ... In the Figure 4e, “LY29553” and “LY” should be corrected to “LY2955303”. The revised figures are given in this correction.
The online version should be corrected to read: Does the gentleman wish to be heard on the point of order? July 9, 2009 on Page H7933 the following ...
Save button saving states should be corrected to match colors #4690. Closed. nielslyngsoe opened this issue on Feb 21, 2019 · 2 comments · Fixed by #4736.
I35The online version should be corrected to read: OFFICE OF THE CLERK, HOUSE OF REPRESENTATIVES, Washington, DC, October 29, 2015. Hon.
G6PT mutation c.1019-1039delTCTCCTCGTATGGCCCCATT should be corrected to c.1020-1039del20fsX7, and the protein mutation should be p. F340LfsX7.
Mr. Speaker, last The online version should be corrected to read: Mr. PETERS of California asked and was given Mr. PETERS of California.
March 05, 2009 on Page H2997 the following appeared: to House Resolution 205 and rule The online version should be corrected to read: to House Resolution ...

Alternatives:

should be changed to
should be fixed to
should be adjusted to
should be amended to
should be rectified to

This phrase is correct and commonly used when talking about transforming something into a different form or state.

"should be corrected into"

This phrase is used when indicating the transformation of something into a different form or state, rather than just correcting an error or mistake.

Examples:

The raw data should be corrected into a readable format.
The story should be corrected into a screenplay.

Show examples from the web [+]

Jul 5, 2021 ... Figure 1b, the labels should be corrected into “K439E, K409D” in panel #2 and #4. An external file that holds a picture, illustration, etc.
Sep 22, 2020 ... **All "Rhinolophus affinis" in Table 1 should be corrected into "Rhinolophus sinicus"**. The corrected **Table 1** appears below.
... of the Journal of Thoracic Disease (JTD), there was an error in the name of the author: the name “Zhiming Qiu” should be corrected into “Minzhi Qiu”.
75, the original sentence “Erosion resistance for waterjet tooling and abrasive sharpening [249]” should be corrected into “Erosion resistance for waterjet ...
Column “Description” of Table 9-2, last but one row: the content should be corrected into. “DMU stand-by data memory (SBRAM)”.+. Page 9-9.
Nov 19, 2014 ... of Regulation (EU) No 1303/2013 should be corrected into a reference to point (a) of Article 126 of Regulation. (EU) No 1303/2013.
Jun 2, 2016 ... should be corrected into ' $\sum\nolimits_{k=1}^{6}{{ '. ... line below equation (16), 'k = 0, 1, 2, 3', should be corrected into 'k = 0–6'.
... (c) of Article 126 of Regulation (EU) No 1303/2013 should be corrected into a reference to point (a) of Article 126 of Regulation (EU) No 1303/2013.
Apr 10, 2018 ... logarithm of viscosity value via sigmoidal fitting'' on page 1372, left column, line 10, should be corrected into ''the logarithm of.

Alternatives:

should be transformed into
should be converted into
should be changed into
should be modified into
should be turned into

Our Customers Love Us!

We have an average rating of 4.79 stars based on 283125 votes, and

4.9 Excellent - Reviews 2.137

"7 years without any disappointment. Always 100% satisfied. You guys are the best in the world at what you do. Thank you so much :)"

Zubair
from Bangladesh

"I wasn't aware of this service, it's fascinating and more reliable than standard IA tools available on the internet"

Arturo
from Mexico

"In a world of text messages and online communication, this is great to have as a live tool. Thank you."

Selena
from USA

"Wow, it's just so excellent. I never would have believed I could have a sure and excellent English companion. Thanks, TextRanch."

Ifiok
from Nigeria

"This is my first time using TextRanch, and I like how the editors take time to correct my text. To everyone who has never used TextRanch before, I highly recommend trying it."

Wilson
from France

"It is an amazing source of feedback because, as a non-native speaker, I really need to have a reliable helper correct my text."

Susan
from Germany