should be corrected to vs should be corrected into

Both phrases are correct, but they are used in different contexts. 'Should be corrected to' is used when referring to the correction of errors or mistakes in a specific form or content. On the other hand, 'should be corrected into' is used when talking about transforming something into a different form or state.

Last updated: April 12, 2024 • 231 views

should be corrected to

This phrase is correct and commonly used when referring to the correction of errors or mistakes in a specific form or content.

This phrase is used when indicating the correct version or form that something should take after an error or mistake has been identified.

Examples:

The spelling of that word should be corrected to 'receive'.
The address in the document should be corrected to the new location.

Show examples from the web [+]

... how small amounts of astigmatism affect visual acuity and the minimum astigmatism values that should be corrected to achieve maximum visual performance.
Madam The online version should be corrected to read: Mr. BONNER of Alabama. Madam January 22, 2008--On Page E59 the following appeared: Ms. SOLIS.
Sep 15, 2020 ... In the Figure 4e, “LY29553” and “LY” should be corrected to “LY2955303”. The revised figures are given in this correction.
The online version should be corrected to read: Does the gentleman wish to be heard on the point of order? July 9, 2009 on Page H7933 the following ...
Save button saving states should be corrected to match colors #4690. Closed. nielslyngsoe opened this issue on Feb 21, 2019 · 2 comments · Fixed by #4736.
I35The online version should be corrected to read: OFFICE OF THE CLERK, HOUSE OF REPRESENTATIVES, Washington, DC, October 29, 2015. Hon.
G6PT mutation c.1019-1039delTCTCCTCGTATGGCCCCATT should be corrected to c.1020-1039del20fsX7, and the protein mutation should be p. F340LfsX7.
Mr. Speaker, last The online version should be corrected to read: Mr. PETERS of California asked and was given Mr. PETERS of California.
March 05, 2009 on Page H2997 the following appeared: to House Resolution 205 and rule The online version should be corrected to read: to House Resolution ...

Alternatives:

should be changed to
should be fixed to
should be adjusted to
should be amended to
should be rectified to

should be corrected into

This phrase is correct and commonly used when talking about transforming something into a different form or state.

This phrase is used when indicating the transformation of something into a different form or state, rather than just correcting an error or mistake.

Examples:

The raw data should be corrected into a readable format.
The story should be corrected into a screenplay.

Show examples from the web [+]

Jul 5, 2021 ... Figure 1b, the labels should be corrected into “K439E, K409D” in panel #2 and #4. An external file that holds a picture, illustration, etc.
Sep 22, 2020 ... **All "Rhinolophus affinis" in Table 1 should be corrected into "Rhinolophus sinicus"**. The corrected **Table 1** appears below.
... of the Journal of Thoracic Disease (JTD), there was an error in the name of the author: the name “Zhiming Qiu” should be corrected into “Minzhi Qiu”.
75, the original sentence “Erosion resistance for waterjet tooling and abrasive sharpening [249]” should be corrected into “Erosion resistance for waterjet ...
Column “Description” of Table 9-2, last but one row: the content should be corrected into. “DMU stand-by data memory (SBRAM)”.+. Page 9-9.
Nov 19, 2014 ... of Regulation (EU) No 1303/2013 should be corrected into a reference to point (a) of Article 126 of Regulation. (EU) No 1303/2013.
Jun 2, 2016 ... should be corrected into ' $\sum\nolimits_{k=1}^{6}{{ '. ... line below equation (16), 'k = 0, 1, 2, 3', should be corrected into 'k = 0–6'.
... (c) of Article 126 of Regulation (EU) No 1303/2013 should be corrected into a reference to point (a) of Article 126 of Regulation (EU) No 1303/2013.
Apr 10, 2018 ... logarithm of viscosity value via sigmoidal fitting'' on page 1372, left column, line 10, should be corrected into ''the logarithm of.

Alternatives:

should be transformed into
should be converted into
should be changed into
should be modified into
should be turned into

What Our Customers Are Saying

Our customers love us! We have an average rating of 4.79 stars based on 283,125 votes.
Also check out our 2,100+ reviews on TrustPilot (4.9).

"Amazing! I like that the editors are REAL people and not A.I., like some use. The editors actually see clients as real people and not just apart of their job, and it shows. 💖"
moggie April 2025
"TextRanch has been a great help to me, especially at work because I often email my boss."
Jhey April 2025
"Thank you!"
Sachi Nakama July 2024
"I have literally been through chat, PI, claude, bard and bing and I got conflicting answers! Thank you! Human intelligence reigns!"
Retha July 2024
"Faster than AI"
CYNTHIA December 2023
"This was very helpful and I personally think this site is the best."
Kaden October 2023
"It was extremely thorough and very helpful!"
imperialelisa October 2023
"7 years without any disappointment. Always 100% satisfied. You guys are the best in the world at what you do. Thank you so much :)"
Zubair Alam October 2023
"In a world of text messages and online communication, this is great to have as a live tool. Thank you."
Selena October 2023
"Without textranch I would be stuck!"
宏祐 October 2023
"Accuracy and fast response. Personal comments from editor. Thank you."
Clh September 2023
"I wasn't aware of this service, it's fascinating and more reliable than standard IA tools available on the internet"
Arturo September 2023
"The fact that you can get reliable fast feedback on your texts."
Vinicius Antonio August 2023
"you guys are better than grammarly i'm being honest here"
ordinary July 2023
"OMG! This is really good than any other text correction tools I've used so far. Highly recommend this."
Vehan July 2023
"Very fast and accurate. thank you."
mojtaba July 2023
"I love this app because it's help to writing skills all of students ♥️"
Tarisini July 2023
"This was exactly the mistake I was looking for, the wording dind´t sound right at first. Better than grammarly!"
Ente July 2023
"The immediate help that I received was reassuring and very satisfactory. Thanks."
priiiyanshuu July 2023
"this helps A LOT for my studies."
kathnunez02 June 2023
"Woow!! I would never have expected such precision! Thank you soooo much!!"
Berta June 2023
"Real Time Editor and not AI. Many Thanks."
Priya June 2023
"The very first thing excites me about Textranch is how much your editors care."
sepideh June 2023
"The fact that texts are checked by human editors rather than by AI, etc. I appreciate this!"
Анна June 2023